RETOUR AU SOMMAIRE

 3. La synthèse des protéines

I- Questionnaire à choix multiple
1) Les ARN :
A- n'existent que chez les procaryotes
B- appartiennent à trois catégories différentes
C- sont synthétisés dans le noyau à partir d'une matrice d'ADN
D- sont synthétisés dans le cytoplasme
E- ne nécessitent aucune enzyme pour leur synthèse
2) Les ARN de transfert (ARNt) :
A- ne sont pas des polynucléotides
B- ne contiennent jamais d'uracile
C- peuvent se lier à n'importe quel codon de l'ARNm
D- peuvent établir une liaison chimique avec un acide aminé déterminé et un seul
E- peuvent établir une liaison avec un codon de l'ARNm et un seul
3) Dans une expérience de synthèse protéique in vitro pour laquelle on utilise un ARNm artificiel :
A- si on utilise un polynucléotide "poly-U" comme ARNm, on obtiendra une protéine constituée d'un seul type d'acide aminé
B- si on utilise un polynucléotide "poly-U" comme ARNm on obtiendra plusieurs protéines différentes
C- il suffit d'ajouter des acides aminés, diverses enzymes, des ARNt et des ribosomes à l'ARNm pour que la synthèse ait lieu
D- on est obligé d'ajouter aussi de l'ATP pour que la synthèse se fasse
4) Le code génétique :
A- est différent chez les virus, les bactéries et les eucaryotes
B- représente la correspondance entre le "langage" des acides nucléiques et celui des protéines
C- comporte uniquement des codons spécifiant des acides aminés
D- est formé d'unités - les codons- constitués par trois nucléotides
E- est formé d'unités - les codons- constitués par quatre nucléotides
5) Les ribosomes :
A- n'existent que chez les cellules eucaryotes
B- ne contiennent pas de protéines
C- contiennent de l'ARN
D- sont les organites responsables de la biosynthèse des protéines
E- sont le siège de la synthèse des ARNm

II- Exercice
Séquence des gènes et des protéines correspondantes
La séquence nucléotidique d'un ARNm est indiquée ci-dessous.
Déterminer, d'une part, la séquence des nucléotides du gène correspondant et, d'autre part, la séquences des acides aminés du polypeptide correspondant en vous aidant du code génétique.
ARNm : GCUCGUUGUAAAGACUUCUUUUGGAAAACCUUUACUUCCUGU


Code génétique

III- Exercice
L'expression de l'information génétique
Représenter, sous forme d'une suite de mots reliés par des flêches, les principales molécules et les principaux mécanismes impliqués dans l'expression de l'information génétique.

RETOUR AU SOMMAIRE

TOUS DROITS RÉSERVÉS
Didier Pol © 2002 
dpol#noos.fr

N'hésitez pas à faire connaître vos impressions, commentaires, suggestions etc